BEI Reagent Search

To access your BEI Web Portal Account:

Advanced Search

Select Search Type Search			OR	Choose a Collection Bacteria Select Agents Other Bacteria Critical Reagents Program Ferret Reagents Filariasis Resource Collection Food and Waterborne Fungi Collection Human Microbiome Project Influenza Pandemic Preparedness Innate Immunity Leprosy Research Support MR4 - Malaria Resources Mycobacterium Mycoplasmas Nosocomial Infections Parasitic Protists PFGRC Center Clones Proteomics Research Centers Rickettsiales Sexually Transmitted Agents Schistosome Resource Centers Spirochete Collection Structural Genomics Centers CSGID SSGCID Toxin or Toxoids Vector Resources Viral Select Agents Virus Collection	OR	Choose an Organism Abrin Acanthamoeba sp. Acinetobacter sp. Anaplasma sp. Arboviruses Arenaviruses Arthropod Vectors Aspergillus sp. Babesia sp. Bacillus sp. Bartonella sp. Bacteroides Borrelia sp. Bordetella sp. Brucella sp. Brugia malayi Burkholderia sp. Campylobacter Candida sp. Cavia porcellus Chlamydia sp. Clostridium sp. Coccidioides sp. Coronaviruses Coxiella sp. Cryptosporidium Dengue Ehrlichia sp. Encephalitozoon sp. Ebola Entamoeba sp. Enterococcus sp. Escherichia sp. Filarial Worms Francisella sp. Giardia sp. Hepatitis Hantaviruses Human Microbiome Influenza Interferons Klebsiella Leishmania Leptospira sp. Listeria sp. Malaria Related sp. Marburg Measles/Mumps Mosquitoes Mycobacterium leprae Mycobacterium sp. Mycobacterium tuberculosis Mycoplasma Neisseria sp. Onchocerca volvulus Paramyxoviruses Plasmodium sp. Pox Viruses Ricin Toxin Rickettsias RSV Salmonella sp. Schistosomes Shiga Toxin Shigella sp. Snails Staphylococcus sp. Streptococcus sp. Ticks Toxins Toxoplasma sp. Trypanosoma Vibrio sp. West Nile Virus Wuchereria bancrofti Yersinia sp.

Back to My Search

Login is required to view Product Sheets and Certificates of Analysis.

Having technical issues or questions regarding this product?

Please Contact Us.

BEI Resources currently limits the total number of "Made to Order" items which can be ordered by a registrant to 10 "Made to Order" items per 6 month period. Please check the Availability Status on the items you are ordering and limit orders appropriately.


	MRA-132B Anopheles gambiae A. gambiae G3 Bulk frozen (Preserved Mosquitoes)

Organism:	Anopheles gambiae
Designations:	A. gambiae G3 Bulk frozen
Depositors:	MQ Benedict
Biosafety Level:	1
Shipped:	frozen
Store At:	-80°C
Comments:	Bulk frozen, unsexed, approx. 200 adult mosquitoes Identified to species according to morphologic criteria. Wild eye color, polymorphic at collarless. A sample of 100 individuals is 100% susceptible to dieldrin at 1 ppm for 1 hour in the fourth stage.rDNA IGS region, when PCR amplified with ribosomal DNA 28S 'universal' primer (GTGTGCCCCTTCCTCGATGT) and an equimolar combination of A. gambiae- and A. arabiensis-specific primers (CTGGTTTGGTCGGCACGTTT and AAGTGTCCTTCTCCATCC TA respectively), yields a fragment of 390 bp as determined by agarose gel electrophoresis (Scott et al.). G3 is a mongrel stock that has not been exhaustively defined and has no authentication standards that definitively distinguish it from several other 'wild' A. gambiae stocks. It is distributed 'as is' with accompanying authentication information. Its generally good vigor and 'wild', but polymorphic, nature are its chief virtues.
Availability Status:	In Stock
Citations:	Aknowledgment for publications should read "The following reagent was obtained through the MR4 as part of the BEI Resources Repository, NIAID, NIH: Anopheles gambiae A. gambiae G3 Bulk frozen, MRA-132B, deposited by MQ Benedict."

ATTACHMENTS

Product Information Sheet

PERMITS

Select the country to see the list of permits that may be required for shipping this product.

Country :

More Information


Notices and Disclaimers BEI Resources products are intended for laboratory research purposes only. They are not intended for use in humans. While BEI Resources uses reasonable efforts to include accurate and up-to-date information on this site, BEI Resources makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. BEI Resources does not warrant that such information has been confirmed to be accurate.

Back to My Search	Print This Page