BEI Reagent Search

To access your BEI Web Portal Account:

Advanced Search

Select Search Type Search			OR	Choose a Collection Bacteria Select Agents Other Bacteria Critical Reagents Program Ferret Reagents Filariasis Resource Collection Food and Waterborne Fungi Collection Human Microbiome Project Influenza Pandemic Preparedness Innate Immunity Leprosy Research Support MR4 - Malaria Resources Mycobacterium Mycoplasmas Nosocomial Infections Parasitic Protists PFGRC Center Clones Proteomics Research Centers Rickettsiales Sexually Transmitted Agents Schistosome Resource Centers Spirochete Collection Structural Genomics Centers CSGID SSGCID Toxin or Toxoids Vector Resources Viral Select Agents Virus Collection	OR	Choose an Organism Abrin Acanthamoeba sp. Acinetobacter sp. Anaplasma sp. Arboviruses Arenaviruses Arthropod Vectors Aspergillus sp. Babesia sp. Bacillus sp. Bartonella sp. Bacteroides Borrelia sp. Bordetella sp. Brucella sp. Brugia malayi Burkholderia sp. Campylobacter Candida sp. Cavia porcellus Chlamydia sp. Clostridium sp. Coccidioides sp. Coronaviruses Coxiella sp. Cryptosporidium Dengue Ehrlichia sp. Encephalitozoon sp. Ebola Entamoeba sp. Enterococcus sp. Escherichia sp. Filarial Worms Francisella sp. Giardia sp. Hepatitis Hantaviruses Human Microbiome Influenza Interferons Klebsiella Leishmania Leptospira sp. Listeria sp. Malaria Related sp. Marburg Measles/Mumps Mosquitoes Mycobacterium leprae Mycobacterium sp. Mycobacterium tuberculosis Mycoplasma Neisseria sp. Onchocerca volvulus Paramyxoviruses Plasmodium sp. Pox Viruses Reduviids Ricin Toxin Rickettsias RSV Salmonella sp. Sand Flies Schistosomes Shiga Toxin Shigella sp. Snails Staphylococcus sp. Streptococcus sp. Ticks Toxins Toxoplasma sp. Trypanosoma Vibrio sp. West Nile Virus Wuchereria bancrofti Yersinia sp.

Back to My Search

Login is required to view Product Sheets and Certificates of Analysis.

Having technical issues or questions regarding this product?

Please Contact Us.

BEI Resources currently limits the total number of "Made to Order" items which can be ordered by a registrant to 10 "Made to Order" items per 6 month period. Please check the Availability Status on the items you are ordering and limit orders appropriately.


	NR-29834 Hepacivirus Hepatitis C Expression Clone HevcB.17238.a.A16 (Clones)

Description:	Expression Clone HevcB.17238.a.A16
Organism:	Hepacivirus Hepatitis C
Biosafety Level:	1
Availability Status:	In Stock
Store at:	-60°C or colder
Contributor:	Seattle Structural Genomics Center for Infectious Disease
Comments:	Quantity limit per order for this item is 1. This item can be ordered once a year. Orders over this limit will be sent to NIAID for approval before shipment. NR-29834 is a genome polyprotein from hepatitis C virus that has been cloned into AVA0421 for expression in Escherichia coli (E. coli). It is located in well B06 of SSGCID Expression Clone Set 61, NR-29461. NR-29461 is a protein expression clone plate containing genes amplified from hepatitis C virus and Toxoplasma gondii, strain ME49. Select open reading frames from these organisms were cloned into vector AVA0421 (a pET14b derivative) in E. coli, strain Rosetta Oxford using ligation-independent cloning (LIC). The Rosetta Oxford strain was modified from the parent strain, Rosetta™ (Novagen®), by the Structural Genomics Consortium (SGC) in Toronto to be T1 and T5 phage resistant. The Rosetta™ strain also carries the pRARE plasmid with resistance to chloramphenicol and encodes six rare tRNAs. The AVA0421 vector contains a T7 promoter, an ampicillin resistance gene, LIC forward and reverse primer sites (LIC-forward 5'-GGGTCCTGGTTCATG-3'; LIC-reverse 5'-CTTGTTCGTGCTGTTTATTA-3') and an N-terminal His₆-tag that is cleavable by a 3C protease. Detailed information for each clone on the plate is shown on the attached Product Information Sheet. Information about specific clones may also be accessed through the Seattle Structural Genomics Center for Infectious Disease (SSGCID). Every inoculated well of each 96-well plate contains approximately 60 µL of E. coli culture (strain Rosetta Oxford) in Luria Bertani (LB) broth containing 100 µg/mL ampicillin supplemented with 15% glycerol. Note: Production in the 96-well format has increased risk of cross-contamination between adjacent wells. Individual clones should be purified (e.g. single colony isolation and purification using good microbiological practices) and sequence verified prior to use. BEI Resources cannot confirm or validate any clone not identified on the plate information table found on the Product Information Sheet.
Citations:	Acknowledgment for publications should read "The following reagent was provided by the NIH Seattle Structural Genomics Centers for Infectious Disease, NIAID, for distribution by BEI Resources, NIAID, NIH: SSGCID Protein Expression Clone Set 61, Recombinant in Escherichia coli, NR-29461."
Sequence:	ATGGCCCTGAGCAACTCTCTCCTTCGTCACCATAACATGGTTTATGCTACCACCAGCCGTTC TGCAGGTCTCCGTCAGAAAAAAGTGACTTTCGACCGCCTGCAGGTTCTTGACGACCACTACC GTGACGTACTGAAAGAGATGAAAGCTAAAGCATCCACCGTTAAGGCCAAGCTGCTGTCTGTA GAAGAAGCCTGCAAACTGACCCCGCCGCATAGCGCTAAGTCTAAATTCGGTTACGGTGCAAA GGACGTCCGTAACTTATCCAGCAAGGCAGTGAACCACATCCACAGCGTATGGAAGGACCTGC TTGAAGACACCGTTACTCCTATCGACACCACCATCATGGCTAAGAATGAAGTGTTTTGCGTT CAGCCGGAGAAAGGCGGCCGTAAGCCAGCTCGTCTTATTGTGTTCCCTGACTTAGGCGTGCG CGTTTGCGAGAAAATGGCACTGTACGATGTTGTATCCACTCTGCCGCAAGTTGTGATGGGCT CTTCTTACGGTTTCCAATATAGCCCGGGCCAGCGCGTTGAGTTCCTCGTTAACACCTGGAAG TCCAAAAAAAACCCGATGGGTTTCAGCTATGACACCCGTTGCTTTGATAGCACTGTGACCGA GAATGACATCCGTGTTGAGGAATCTATCTATCAGTGCTGCGACCTGGCTCCGGAAGCTCGTC AGGCTATTAAATCCCTGACTGAACGTCTGTACATAGGCGGTCCGCTGACTAATTCTAAAGGC CAGAACTGCGGCTATCGCCGCTGCCGTGCTTCCGGCGTGCTGACCACTAGCTGCGGCAACAC CCTGACCTGCTACCTGAAAGCGAGCGCTGCCTGCCGTGCCGCCAAACTCCAGGATTGTACCA TGTTAGTTAACGGTGACGACTTAGTTGTGATCTGTGAATCTGCCGGTACTCAGGAAGACGCT GCCAGCCTGCGTGTGTTCACTGAAGCCATGACTCGTTACTCCGCACCTCCGGGTGACCCACC GCAGCCTGAATATGACCTGGAACTGATTACCAGCTGTAGCAGCAACGTTAGCGTCGCTCACG ATGCTTCCGGTAAACGTGTTTATTACCTGACTCGTGATCCTACCACTCCGTTAGCTCGTGCC GCTTGGGAAACCGCTCGTCATACTCCGGTGAACTCCTGGTTAGGCAACATCATTATGTACGC ACCTACCCTGTGGGCACGCATGATCCTGATGACCCATTTCTTCTCGATTCTCTTAGCTCAAG AACAACTGGAGAAGGCGCTTGATTGCCAAATCTACGGCGCCTGCTACTCCATCGAGCCGCTC GATCTGCCACAGATAATCGAACGTCTGCACGGTCTGAGCGCATTCTCTCTGCACTCTTATTC TCCTGGTGAAATCAACCGTGTAGCTAGCTGCCTGCGTAAATTAGGCGTTCCACCACTGCGTG TGTGGCGTCATCGCGCACGTTCCGTTCGCGCCCGTCTGCTGTCCCAGGGTGGCCGTGCAGCT ACCTGCGGTAAATACTTATTTAACTGGGCTGTTAAGACTAAGCTGAAACTGACTCCTATCCC AGCCGCTAGCCAACTCGACTTGAGCGGTTGGTTCGTAGCTGGCTACTCCGGCGGTGATATAT ACCAC
Insert Size:	1617

ATTACHMENTS

Product Information Sheet

Certificate of Analysis by Lot

61032784

PERMITS

Select the country to see the list of permits that may be required for shipping this product.

Country :

More Information


Notices and Disclaimers BEI Resources products are intended for laboratory research purposes only. They are not intended for use in humans. While BEI Resources uses reasonable efforts to include accurate and up-to-date information on this site, BEI Resources makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. BEI Resources does not warrant that such information has been confirmed to be accurate.

Back to My Search	Print This Page