Contact Us   Having technical issues or questions regarding this product?
Please Contact Us.
BEI Resources currently limits the total number of "Made to Order" items which can be ordered by a registrant to 10 "Made to Order" items per 6 month period. Please check the Availability Status on the items you are ordering and limit orders appropriately.
NR-52358   Quantitative Synthetic RNA from SARS-Related Coronavirus 2
(Nucleic Acids)
Price: All BEI Resources products are provided
at no cost to registered researchers.
Description: Quantitative Synthetic RNA from SARS-Related Coronavirus 2
Organism: SARS-Related Coronavirus 2
Biosafety Level: 1
Availability Status: In Stock
Store at: -60°C or colder
Contributor: ATCC®
Quantity limit per order for this item is 1. This item can be ordered twice a year. Orders over this limit will be sent to NIAID for approval before shipment.

Quantitative synthetic RNA from SARS-related coronavirus 2 can be used for assay development, verification, validation, monitoring of day-to-day test variation and lot-to-lot performance of molecular-based assays. The quantitative format allows for the generation of a standard curve for quantitative PCR (qPCR) to determine viral load.

Preparation includes fragments from the ORF 1ab, Envelope (E) and Nucleocapsid (N) regions.

The following primers and probe can be used with this nucleic acid preparation: Forward primer (5’ to 3’): GACCCCAAAATCAGCGAAAT; Reverse primer (5’ to 3’): TCTGGTTACTGCCAGTTGAATCTG; Probe (5’ to 3’): FAM/ACCCCGCATTACGTTTGGTGGACC/BHQ1.

Each vial contains approximately 110 µL of synthetic RNA in RNAstable (Biomatrica® 52201-013).
Citations: Acknowledgment for publications should read "The following reagent was obtained through BEI Resources, NIAID, NIH: Quantitative Synthetic RNA from SARS-Related Coronavirus 2, NR-52358."
For a list of permits that may be required for shipping this product and to set the permit information preferences; please select a country from the drop down below.

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.

Return to Top

Notices and Disclaimers

BEI Resources products are intended for laboratory research purposes only. They are not intended for use in humans.

While BEI Resources uses reasonable efforts to include accurate and up-to-date information on this site, BEI Resources makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. BEI Resources does not warrant that such information has been confirmed to be accurate.

Back to My Search