Disclaimer: You are now leaving www.beiresources.org and are going to a website that is not operated by BEI Resources. We are not responsible for the content or availability of linked sites.
ABOUT THIRD PARTY LINKS ON OUR SITE: BEI Resources offers links to other third party websites that may be of interest to our website visitors. The links provided in our website are provided solely for your convenience and may assist you in locating other useful information on the Internet. When you click on these links, you will leave the BEI Resources website and will be redirected to another site. These sites are not under the control of BEI Resources. BEI Resources is not responsible for the content of linked third party websites. We are neither an agent for these third parties nor do we endorse or guarantee their products. We make no representation or warranty regarding the accuracy of the information contained in the linked sites. We suggest that you always verify the information obtained from linked websites before acting upon this information. Please read third party privacy and security policies closely as these may be different than BEI Resources policies. If you have any questions or concerns about the products and services offered on linked third party websites, please contact the third party directly.
Are you sure you would like to be notified when the item is available?
Quantity limit per order for this item is 1. This item can be ordered twice a year. Orders over this limit will be sent to NIAID for approval before shipment.
ARP-1520 [HIV-1 LTR CAT reporter vector (pCD54E8)] is a deletion mutant where the 5' end of the LTR to position -48 from the transcriptional start site is deleted, however, the presence of the NFκB enhancer sequence results in restored transcriptional activity as determined by CAT assay. The LTR sequences are cloned upstream to the CAT gene. To produce this vector clone pC15CAT (BEI Resources ARP-1527) a derivative of pSV0CAT, was cleaved with KpnI, treated with Bal31 exonuclease, blunted and the XbaI linkers ligated. The resultant deletion mutant, pCD54E8, contains HIV-1IIIB LTR sequences from -48 to +80 located in front of the CAT gene. The NFκB sequence has been cloned into the XbaI site at -48 in the reversed orientation. The NFκB insert sequence is: XbaI XbaI -48 5'-cgcagcgagtcact/ctagatggaaagtccccagcggaaagtccct/ctagag*gcgag-3'.
The provided bacterial host is Escherichia coli, strain DH5α but strain HB101 is also an acceptable host.
Each vial of ARP-1520 contains 1 mL of ampicillin resistant E. coli, strain DH5α transformed with pCD54E8. Please refer to the appropriate data sheet for lot-specific information.
Gorman, C. M., L. F. Moffat and B. H. Howard. “Recombinant Genomes Which Express Chloramphenicol Acetyltransferase in Mammalian Cells.” Mol. Cell Biol. 2 (1982):1044-1051. PubMed: 6960240.
Arya, S. K., et al. “Trans-Activator Gene of Human T-Lymphotropic Virus Type III (HTLV-III).” Science229 (1985):69-73. PubMed: 2990040.
Seikevitz, M., et al. “Activation of the HIV-1 LTR by T Cell Mitogens and the Trans-Activator Protein of HTLV-I.” Science 238 (1987):1575-1578. PubMed: 2825351.
Chang, K. S., w. T. Liu and S. F. Josephs. “Regulation of Cellular Trans-Activating Activities in Two Different Promonocytic Leukemia Cell Lines.” Cancer Lett. 60 (1991):75-83. PubMed: 1913629.
Seigel, L. J., et al. “Transactivation Induced by Human T-Lymphotropic Virus Type III (HTLV III) Maps To A Viral Sequence Encoding 58 Amino Acids and Lacks Tissue Specificity.” Virology 148 (1986): 226-231. PubMed: 3002031.
When applying for permits and forms please:
Do NOT reference BEI Resources or ATCC Catalog Numbers in the Material Description fields found on the permits and/or forms.
Make sure your name and address on the permit applications and/or forms are exactly as they appear on your BEI Resources registration.
Information about permits is provided as a courtesy to BEI Resources customers. While we use reasonable efforts to include accurate and up-to-date information on this page, we make no warranties or representation as to its accuracy.
For more information on the necessary compliance requirements associated with the biological materials provided by BEI Resources, please select this link: Compliance Requirements.