Contact Us   Having technical issues or questions regarding this product?
Please Contact Us.
BEI Resources currently limits the total number of "Made to Order" items which can be ordered by a registrant to 10 "Made to Order" items per 6 month period. Please check the Availability Status on the items you are ordering and limit orders appropriately.
MRA-336   Anopheles gambiae Complex, PCR Identification Primer Kit
(Primers and Probes)
Price: All BEI Resources products are provided
at no cost to registered researchers.
Description: Anopheles gambiae Complex, PCR Identification Primer Kit
Organism: Anopheles gambiae
Biosafety Level: 1
Availability Status: In Stock
Store at: -20°C (-80°C long term storage)
Contributor: MQ Benedict
Comments:
Quantity limit per order for this item is 1. This item can be ordered once a year. Orders over this limit will be sent to NIAID for approval before shipment.

This reagent was authenticated by the contributor. BEI Resources has not confirmed or validated this material. Please contact BEI Resources for directions for use.


MRA-336 contains a set of 9 cryotubes containing dried oligonucleotides (shown below) for identification of members of the Anopheles gambiae complex by PCR, after preliminary morphological identification as members of the species complex. Two tubes of UN and AR are supplied; all other primers are unique. The product sizes predicted are those obtained by amplification of the ribosomal DNA (rDNA) intergenic spacer according to the references below. Products are typically resolved by agarose gel electrophoresis and compared to molecular weight standards. Use of positive and negative controls is strongly encouraged.

Primer name/species/fragment length/µg per tube/sequence

UN/all/not applicable/12.5/GTGTGCCCCTTCCTCGATGT
GA/gambiae/390 bp/6.25/CTGGTTTGGTCGGCACGTTT
AR/arabiensis/315 bp/18.75/AAGTGTCCTTCTCCATCC TA
ME/melas, merus/464 bp, 466 bp/12.5/TGACCAACCCACTCCCTTGA
BW/bwambe/152 bp/6.25/GACCAAGATGGTTAGTTAACA
QD/quadriannulatus/153 bp/25/CAGACCAAGATGGTTAGTAT
QDA/alternate quadriannulatus/415 bp/25/CATAATGAGTGCACAGCATA

Note: Use of the QDA primer is recommended when samples are collected from locations in which A. merus and A. quadriannulatus may be sympatric.

Scott, J. A., W. G. Brogdon and F. H. Collins. "Identification of Single Specimens of the Anopheles gambiae Complex by the Polymerase Chain Reaction." Am. J. Trop. Med. Hyg. 49 (1993): 520-529. PubMed: 8214283.
Cornel, A. J. and F. H. Collins. "PCR of the Ribosomal DNA Intergenic Spacer Regions as a Method for Identifying Mosquitoes in the Anopheles gambiae Complex." Methods Mol. Biol. 50 (1996): 321-332. PubMed: 8751368.
Collins, F. H., et al. "A Ribosomal RNA Gene Probe Differentiates Member Species of the Anopheles gambiae Complex." Am. J. Trop. Med. Hyg. 37 (1987): 37-41. PubMed: 2886070.
Rafferty, C. S., et al. "Polymerase Chain Reaction-Based Identification and Genotyping of Anopheles Mosquitoes with a 96-Pin Bacterial Replicator." Am. J. Trop. Med. Hyg. 66 (2002): 234-237. PubMed: 12139213.
Citations: Acknowledgment for publications should read "The following reagent was obtained through BEI Resources, NIAID, NIH: Anopheles gambiae Complex, PCR Identification Primer Kit, MRA-336, contributed by Mark Q. Benedict."
PERMITS
For a list of permits that may be required for shipping this product and to set the permit information preferences; please select a country from the drop down below.

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.

RELATED PRODUCTS
MRA-857
Plasmid Control Papers for Anopheles gambiae and Anopheles arabiensis rDNA IGS Identification
Return to Top


Notices and Disclaimers

BEI Resources products are intended for laboratory research purposes only. They are not intended for use in humans.

While BEI Resources uses reasonable efforts to include accurate and up-to-date information on this site, BEI Resources makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. BEI Resources does not warrant that such information has been confirmed to be accurate.


Back to My Search