Contact Us   Having technical issues or questions regarding this product?
Please Contact Us.
BEI Resources currently limits the total number of "Made to Order" items which can be ordered by a registrant to 10 "Made to Order" items per 6 month period. Please check the Availability Status on the items you are ordering and limit orders appropriately.
MRA-132B  Anopheles gambiae, G3, Bulk Frozen
(Vectors)
Price: All BEI Resources products are provided
at no cost to registered researchers.
Designations: G3, Bulk Frozen
Organism: Anopheles gambiae
Biosafety Level: 1
Availability Status: In Stock
Store at: -80°C
Contributor: MQ Benedict
Comments:
Quantity limit per order for this item is 1. This item can be ordered twice a year. Orders over this limit will be sent to NIAID for approval before shipment.

Anopheles gambiae (A. gambiae) G3 stock was identified to species according to morphologic criteria (wild eye color, polymorphic at collarless). A sample of 100 individuals is 100% susceptible to dieldrin at 1 ppm for 1 hour in the fourth stage. When PCR amplified with ribosomal DNA 28S 'universal' primer (GTGTGCCCCTTCCTCGATGT) and an equimolar combination of A. gambiae- and A. arabiensis-specific primers (CTGGTTTGGTCGGCACGTTT and AAGTGTCCTTCTCCATCC TA, respectively), the rDNA IGS region yields a 390-bp fragment as determined by agarose gel electrophoresis. G3 is a mongrel stock that has not been exhaustively defined and has no authentication standards that definitively distinguish it from several other 'wild' A. gambiae stocks. It is distributed 'as is' with accompanying authentication information. Its generally good vigor and 'wild', but polymorphic, nature are its chief virtues.

MRA-132B contains approximately 200 unsexed, adult wild-type A. gambiae, strain G3 mosquitoes, which were preserved in liquid nitrogen (quick-frozen) while alive. MRA-132B is suitable for DNA and RNA isolation, protein extraction, etc.

Citations: Acknowledgment for publications should read "The following reagent was obtained through BEI Resources, NIAID, NIH: Anopheles gambiae, Strain G3, Bulk Frozen, MRA-132B, contributed by Mark Q. Benedict."
PERMITS
For a list of permits that may be required for shipping this product and to set the permit information preferences; please select a country from the drop down below.

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.

RELATED PRODUCTS
MRA-112
Anopheles gambiae G3, Eggs
MRA-132K
Anopheles gambiae G3, Frozen Kit (10 Male and 10 Female)
Return to Top


Notices and Disclaimers

BEI Resources products are intended for laboratory research purposes only. They are not intended for use in humans.

While BEI Resources uses reasonable efforts to include accurate and up-to-date information on this site, BEI Resources makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. BEI Resources does not warrant that such information has been confirmed to be accurate.


Back to My Search